circad | circRNAs associated with diseases

circRAPGEF5
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Papillary Thyroid Carcinoma	ICD-10	Thyroid and other endocrine glands (D09.3)
DBLink	Link to database	PMID	30785065
Experimental Method
Sample Type	Tissue and cell lines	Comparison	PTC tissues and paired adjacent noncancerous thyroid tissues were collected from 30 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCCTCTCATTCCTGCCAGA Reverse TCTTGATAGAGTCGCAGATGTTAGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Liu, W, Zhao, J, Jin, M, Zhou, M (2019). circRAPGEF5 Contributes to Papillary Thyroid Proliferation and Metastatis by Regulation miR-198/FGFR1. Mol Ther Nucleic Acids, 14:609-616.